View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3996_low_15 (Length: 261)
Name: NF3996_low_15
Description: NF3996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3996_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 39621140 - 39621374
Alignment:
| Q |
11 |
cagagacgcaagatggcgaacaaactcatcaaccaattaggtttacccaaatccatcgctaacatcttcaccgctcgcaacatcatcaccgccaaggtat |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39621140 |
cagaaacgcaagatggcgaacaaactcatcaaccaattaggtttacccaaatccatcgctaacatcttcaccgctcgcaacatcatcaccgccaaggtat |
39621239 |
T |
 |
| Q |
111 |
cctcactatttacttttcccctttcaattttacatgacctaattagtaacgcctttttgaaaaattgcaggatgcattatctctcactgaatttgaattg |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39621240 |
cctcactatttccttttcccctttcaattttacatgacctaattagtaacgcctttttgaaaaattgcaggatgcattatctctcactgaatttgaattg |
39621339 |
T |
 |
| Q |
211 |
atggagttgttagatgttggtatgtcagaagtaac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39621340 |
atggagttgttagatgttggtatgtcagaagtaac |
39621374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University