View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3997_high_7 (Length: 216)
Name: NF3997_high_7
Description: NF3997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3997_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 11 - 90
Target Start/End: Original strand, 14158970 - 14159049
Alignment:
| Q |
11 |
ataatactaatataaatcctagttattggattttgttttatcgaaccgtggtaagatcatagtatggaacatagtgttgg |
90 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14158970 |
ataatattaatataaatcctagttattggattttgttttatcaaaccgtggtaagatcatagtatggaacatagtgttgg |
14159049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 93 - 202
Target Start/End: Original strand, 14160220 - 14160333
Alignment:
| Q |
93 |
ggtgacaatctgatatgagaataaaataagtgtagtggagatc------ccgtgaatgtgttgtaagattacacatgtgatatgattataaatgatcata |
186 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
14160220 |
ggtgacaaactgatatgagaataaaataagtgtagtggagatcaggttgcagtgaatgtgttgtaagattaca--tgtgataggattataaatgatcata |
14160317 |
T |
 |
| Q |
187 |
atagagttggggtaac |
202 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14160318 |
atagagttggggtaac |
14160333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University