View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3998_high_29 (Length: 344)
Name: NF3998_high_29
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3998_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 6 - 159
Target Start/End: Complemental strand, 3873038 - 3872885
Alignment:
| Q |
6 |
cagagaacaaggggatcatcagctgcaaagnnnnnnntaacttatgatgaagccaagatgtatctcaatgaaataaaggatgcttttaaagatgagaagc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3873038 |
cagagaacaaggggatcatcagctgcaaagaaaaaaataacttatcatgaagccaagatgtatctcaatgaaataaaggatgcttttaaagatgagaagc |
3872939 |
T |
|
| Q |
106 |
ataagtattatgaatttttaagagtcttgaaagatttcgagaaacgaaggtttg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3872938 |
ataagtattatgaatttttaagagtcttgaaagatttcgagaaacgaaggtttg |
3872885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 240 - 344
Target Start/End: Complemental strand, 3872814 - 3872710
Alignment:
| Q |
240 |
cactttgatgtatttatagaattgatctggagggtgtggtggcaagagtgaaggaaatttttcaagggcatgatgaattgttactgaaatttcaaacctt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3872814 |
cactttgatgtatttatagaattgatctggagggtgtggtggcaagagtgaaggaattttttcaagggcatgatgaattgttactgaaatttcaaacctt |
3872715 |
T |
|
| Q |
340 |
tttgc |
344 |
Q |
| |
|
||||| |
|
|
| T |
3872714 |
tttgc |
3872710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University