View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3998_high_32 (Length: 341)
Name: NF3998_high_32
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3998_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 33372178 - 33372316
Alignment:
| Q |
1 |
catgggtgagaccaaagatgaggaagttggggtgtggtgtaaggtgaagagtggttgttatagcgttgatttcttcaaaggacatggatttggtggtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33372178 |
catgggtgagaccaaagatgaggaagttggggtgtggtgtaaggtgaagagtggttgttatagcgttgatttcttcaaaggacatggatttggtggtggt |
33372277 |
T |
|
| Q |
101 |
gtttgaggaggaggcatagtggaggagggctttggttac |
139 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33372278 |
gtttaaggaggaggcatagtggaggagggctttggttac |
33372316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 220 - 322
Target Start/End: Original strand, 33372397 - 33372499
Alignment:
| Q |
220 |
agactatagtgaagaatgttagaaggaagaagaaaagccaaagacggtgagagtgaaagggtgttgttggagcttgtttgtgaagagaaggatggagaag |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33372397 |
agactatagtgaagaatgttagaaggaagaagaaaagccaaagacggtgagagtgaaagggtgttgttggagcttgtttgtgaagagaatgatggagaag |
33372496 |
T |
|
| Q |
320 |
tat |
322 |
Q |
| |
|
||| |
|
|
| T |
33372497 |
tat |
33372499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 3 - 138
Target Start/End: Original strand, 33367979 - 33368114
Alignment:
| Q |
3 |
tgggtgagaccaaagatgaggaagttggggtgtggtgtaaggtgaagagtggttgttatagcgttgatttcttcaaaggacatggatttggtggtggtgt |
102 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
33367979 |
tgggtgagaccaaagataaggaagttggggtttggtgtaaggtgaagagtggttgttatggcgttgatttctgaaaaggacatggatttggtggtggagt |
33368078 |
T |
|
| Q |
103 |
ttgaggaggaggcatagtggaggagggctttggtta |
138 |
Q |
| |
|
| ||||||||||| ||||| | ||| ||||| |||| |
|
|
| T |
33368079 |
tcgaggaggaggcgtagtgaacgagagctttagtta |
33368114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University