View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3998_high_48 (Length: 248)

Name: NF3998_high_48
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3998_high_48
NF3998_high_48
[»] chr5 (2 HSPs)
chr5 (1-99)||(12818712-12818810)
chr5 (210-239)||(12818921-12818950)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 12818712 - 12818810
Alignment:
1 ttcggagaagaaataattgagagaaagagaagtttaggatttccaagaagtgaagtgaaattcttggttggttttaataaattagggttttgaagtgat 99  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
12818712 ttcgaagaagaaataattgagagaaagagaagtttaggatttccaagaagtgaagtgaaattcttggttggttataataaattagggttttgaagtgat 12818810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 239
Target Start/End: Original strand, 12818921 - 12818950
Alignment:
210 gacatcgcgctctttctctttctctctctg 239  Q
    ||||||||||||||||||||||||||||||    
12818921 gacatcgcgctctttctctttctctctctg 12818950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University