View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3998_high_49 (Length: 245)
Name: NF3998_high_49
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3998_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 94 - 191
Target Start/End: Original strand, 53029015 - 53029112
Alignment:
| Q |
94 |
ttagtcgatcaaatttgattagtcatctataatacaatgaatcaatgttgaatatcaaccgagagatatccatatttgtattcgaaggtatttcgaat |
191 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53029015 |
ttagtcgatcaaattggattagtcatctataatacaatgaatcaatgttgaatatcaaccgagaaatatccatatttgtattcgaaggtatttcgaat |
53029112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 53028123 - 53028219
Alignment:
| Q |
1 |
tttgaatttgttcatttaaactatttgaatgatnnnnnnnncatgtatacgtactcttgtnnnnnnnnntgcatactagtcgcttataaaggtttag |
97 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||| || |||||||||| |||||||||||||| |
|
|
| T |
53028123 |
tttgaatttgtccatttaaactatttgaatgataaaaaaaacatgtatacgtactcttgtaaaaaaaaatgtatactagtcgattataaaggtttag |
53028219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University