View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3998_high_58 (Length: 222)
Name: NF3998_high_58
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3998_high_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 420602 - 420389
Alignment:
| Q |
1 |
tcaattatcaagagtacataacaaaattttccacaataacatgattagagaaattgagtttaaaacatactcaactaagcactctattggagtaattaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420602 |
tcaattatcaagagtacataacaaaattttccacaataacatgattagagaaattgagtttaaaacatactcaactaagcactctattggagtaattaaa |
420503 |
T |
 |
| Q |
101 |
aagtttgaactttttagcaccccatgattgnnnnnnnnnncttcctattgggtctaaagtaatatgttttaggcaatgcatgttttctcattggttaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
420502 |
aagtttgaactttttagcaccccatgattgtttttttt---ttcctattgggtctaaagtaatatgttttaggcaatacatgttttctcattggttaact |
420406 |
T |
 |
| Q |
201 |
gtggatcctatgcttct |
217 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
420405 |
gtggatcctatgattct |
420389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University