View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3998_high_59 (Length: 217)

Name: NF3998_high_59
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3998_high_59
NF3998_high_59
[»] chr8 (1 HSPs)
chr8 (62-206)||(32482792-32482936)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 62 - 206
Target Start/End: Original strand, 32482792 - 32482936
Alignment:
62 gatgatatgcatgctgcacggccgttcttcccgcgagatctctacggtccaggagttggtttaggtgttggaccaagcagggtttcatcagatgatcatg 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32482792 gatgatatgcatgctgcacggccgttcttcccgcgagatctctacggtccaggagttggtttaggtgttggaccaagcagggtttcatcagatgatcatg 32482891  T
162 aacatcaatcgtcgtcgagatcggcggcgtttactatggtgatga 206  Q
    ||||||||||||||||||||||||||||||||||||||| |||||    
32482892 aacatcaatcgtcgtcgagatcggcggcgtttactatggcgatga 32482936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University