View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3998_high_59 (Length: 217)
Name: NF3998_high_59
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3998_high_59 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 62 - 206
Target Start/End: Original strand, 32482792 - 32482936
Alignment:
| Q |
62 |
gatgatatgcatgctgcacggccgttcttcccgcgagatctctacggtccaggagttggtttaggtgttggaccaagcagggtttcatcagatgatcatg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482792 |
gatgatatgcatgctgcacggccgttcttcccgcgagatctctacggtccaggagttggtttaggtgttggaccaagcagggtttcatcagatgatcatg |
32482891 |
T |
|
| Q |
162 |
aacatcaatcgtcgtcgagatcggcggcgtttactatggtgatga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32482892 |
aacatcaatcgtcgtcgagatcggcggcgtttactatggcgatga |
32482936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University