View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3998_low_21 (Length: 397)
Name: NF3998_low_21
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3998_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 18 - 387
Target Start/End: Original strand, 36441966 - 36442335
Alignment:
| Q |
18 |
ccaatgaacttcgtttggccaaaagagtatctagtgaatgcaaatgaagagtttcaagcaccattgatagaccttgatgggttccttaaaggtaatgaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36441966 |
ccaatgaacttcgtttggccaaaagagtatctagtgaatgcaaatgaagagtttcaagcaccattgatagaccttgatgggttccttaaaggtaatgaag |
36442065 |
T |
|
| Q |
118 |
aaaccacaaacaatgttgcaaagctcatatccaaagcttgttcaagtcatggattttttcaagtgattaaccatggtgttgatttgagtctcattggtga |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36442066 |
aaaccacaaacaatgttgcaatgctcatatccaaagcttgttcaactcatggattttttcaagtgattaaccatggtgttgatttgagtctcattggtga |
36442165 |
T |
|
| Q |
218 |
agcttatgatcaaatggatgcnnnnnnnaagcaaccaattgataagaaacttattgctcgtaagataaaaggttcaatgtggggttattctggtgcacat |
317 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36442166 |
agcttatgatcaaatggatgctttttttaagcaaccaattgataagaaacttattgctcgtaagataaaaggttcaatgtggggttattctggtgcacat |
36442265 |
T |
|
| Q |
318 |
gctgataggttctcctccaaattgccttggaaggaaacactttctttcccttttcatgataataatgtct |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36442266 |
gctgataggttctcctccaaattgccttggaaggaaacactttctttcccttttcatgataataatgtct |
36442335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University