View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3998_low_28 (Length: 353)
Name: NF3998_low_28
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3998_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 348
Target Start/End: Complemental strand, 39092378 - 39092031
Alignment:
| Q |
1 |
attacattgaattgatctgtgttctaatcttcacagttatggtcagttaaaccttctggatcacaaaagaagcttccagtagttacttacctcaatagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39092378 |
attacattgaattgatctgtgttctaatcttcacagttatggtcagttaaaccttctggatcacaaaagaagcttccagtagttacttacctcagtagtc |
39092279 |
T |
|
| Q |
101 |
tctcgtatcatagttccgctgttaatgttattcgcttctcttcttccggtaacttcatttcattgaaatttcaannnnnnngttgttacagtaaaaaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39092278 |
tctcgtatcatagttccgctgttaatgttattcgcttctcttcttccggtaacttcatttcattgaaatttcaatttttttgttgttacagtaaaaaatt |
39092179 |
T |
|
| Q |
201 |
aagctttatgtaaataacgannnnnnnnnnnnaatgttttaggggaattgttagcttctggttctgatggtaatatcttgatccctactgttgatttttc |
300 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092178 |
aagctttatgtaaataacgatttttattttttaatgttttaggggaattgttagcttctggttctgatggtaatatcttgatccctactgttgatttttc |
39092079 |
T |
|
| Q |
301 |
tttttgagattttcttaatttgagtttatttatgttgcctatgcttct |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
39092078 |
tttttgagattttcttaatttgagtttatttatgttgccaatgtttct |
39092031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University