View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3998_low_63 (Length: 210)
Name: NF3998_low_63
Description: NF3998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3998_low_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 32572144 - 32572324
Alignment:
| Q |
14 |
gcacagaatccgaaatatgtaattgtttcatatgaaggcaaacataatcatggattgcctatgatcacnnnnnnnn-tccaacaaactcaagtagtacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| | |
|
|
| T |
32572144 |
gcacagaatccgaaatatgtaattgtttcatatgaaggcaaacataatcatggattgcctatgatcacaaaaaaaaatccaacaaactcaagtactacca |
32572243 |
T |
 |
| Q |
113 |
gcaccacagtagtacgtgggaatgctagcattgtatcaccaccttatgcattgccaatgacccaacctttcacacctcttc |
193 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32572244 |
gcacaacagtagcacgtgggaatgctagcatcgtaccaccaccttatgcattggcaatgacccaacctttcacacctcttc |
32572324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University