View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3999_high_23 (Length: 279)
Name: NF3999_high_23
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3999_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 50 - 149
Target Start/End: Original strand, 1969168 - 1969267
Alignment:
| Q |
50 |
ataatatatcgcgtctatttatttataagcaaccttttttactttagaatagcatgttccagctattttacactacttttgtagattacagaatgaactg |
149 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1969168 |
ataatatatcgtgtctatttatttaacagctcccttttttactttagaatagcatgttccagctattttacactacttttgtagattacagaatgaactg |
1969267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 264
Target Start/End: Original strand, 1969345 - 1969374
Alignment:
| Q |
235 |
gatgtatttaattagtaattacgtgcaaat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1969345 |
gatgtatttaattagtaattacgtgcaaat |
1969374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 58
Target Start/End: Original strand, 25780506 - 25780551
Alignment:
| Q |
13 |
gtttccatgagcttaactcaattagcaaagacaatacataatatat |
58 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| | |||||||||| |
|
|
| T |
25780506 |
gtttccatgagcttaactcaattggcaaggacattgcataatatat |
25780551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University