View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3999_high_42 (Length: 231)

Name: NF3999_high_42
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3999_high_42
NF3999_high_42
[»] chr3 (2 HSPs)
chr3 (131-215)||(36388870-36388954)
chr3 (12-54)||(36388752-36388794)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 131 - 215
Target Start/End: Original strand, 36388870 - 36388954
Alignment:
131 ttgtttctcttaattgtgttatgttttactttgggtgaggtgttttgtcttctttgaagggacggaaaaggagaagggaaaaatg 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36388870 ttgtttctcttaattgtgttatgttttactttgggtgaggtgttttgtcttctttgaagggacggaaaaggagaagggaaaaatg 36388954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 12 - 54
Target Start/End: Original strand, 36388752 - 36388794
Alignment:
12 aagcaaagggcgaaactacaacgagcaccgtaaatatgcggct 54  Q
    ||||||| |||||||||||||||||||||||||||||||||||    
36388752 aagcaaaaggcgaaactacaacgagcaccgtaaatatgcggct 36388794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University