View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3999_high_45 (Length: 212)
Name: NF3999_high_45
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3999_high_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 6315199 - 6315377
Alignment:
| Q |
15 |
cataggtattttttaagcttttaaacaatatttggtttttcacttgtaggtaacagtggtcttggataatggtcagaagtatgatggagatctcttggtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315199 |
cataggtattttttaagcttttaaacaatatttggtttttcacttgtaggtaacagtggtgttggataatggtcagaagtatgatggagatctcttggtt |
6315298 |
T |
|
| Q |
115 |
ggagcagatgggatttggtccaaggtcttattaaattctttcttttattcacagttttctatatagtaacttaggggaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6315299 |
ggagcagatgggatttggtccaaggtcttattaaattctttcttttattcatagttttctatatagtaacttaggggaa |
6315377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University