View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3999_low_11 (Length: 462)
Name: NF3999_low_11
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3999_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 277 - 447
Target Start/End: Original strand, 45165576 - 45165746
Alignment:
| Q |
277 |
gccatactttttatttttgctgtgggaaccgacagggtatttacacaaaattgataagtctcatcaaaatcaaatggacgcaacatatgacctacaaaac |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45165576 |
gccatactttttatttttgctgtgggaaccgacagggtatttacacaaaattgataagtctcatcaaaatcaaatggacgcaacatatgacctacaaaac |
45165675 |
T |
|
| Q |
377 |
ccacattgaaattaaatcacgcgtgatggatctgttggccttgcaagatttggttcccatccccacaatat |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45165676 |
ccacattgaaattaaatcacgcgtgatggatctgttggccttgcaagatttggttcccatccccacaatat |
45165746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 152 - 249
Target Start/End: Original strand, 45165451 - 45165548
Alignment:
| Q |
152 |
ttgtttgtaattacaaaataataaatgtctatggtcaagcaacattgtttgtgatgcactttagacatttgagattaaaattaggaatagtagttatg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45165451 |
ttgtttgtaattacaaaataataaatgtctatggtcaagcaacattgtttgtgatgcactttagacatttgagattaaaattaggaatagtagttatg |
45165548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University