View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3999_low_15 (Length: 393)
Name: NF3999_low_15
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3999_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 9e-86; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 13 - 177
Target Start/End: Original strand, 10180880 - 10181044
Alignment:
| Q |
13 |
cagacataaaaaataattagagtaaaagagtgcatacaattgtatagttgatgcaaaaatattaagttaaaatggtaaaaacactctcttcctcctcctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10180880 |
cagacataaaaaataattagagtaaaagagtgcatacaattgtatagttgatgcaaaaatattaagttaaaatggtaaaaacactctcttcctcctcctt |
10180979 |
T |
 |
| Q |
113 |
tcttcgtttttcaagtgatgtttgatggtgtttatttatagggtgagaagaaactaagtttcaga |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10180980 |
tcttcgtttttcaagtgatgtttgatggtgtttatttatagggtgagaagaaattaagtttcaga |
10181044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 275 - 377
Target Start/End: Original strand, 10181511 - 10181610
Alignment:
| Q |
275 |
attagtgatatgccaattttaattgtttaaatgtttgaatgcaacttcgacctgttatnnnnnnnnnnntgcaattttgaactcttattttaactgaaat |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10181511 |
attagtgatatgccaattttaattgtttaaatgtttgaatgcaacttcgacctgttat---aaaaaaaatgcaattttgaactcttattttaactgaaat |
10181607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 10181197 - 10181242
Alignment:
| Q |
160 |
aagaaactaagtttcagaacctactacacatgtgttatgtttggat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10181197 |
aagaaactaagtttcagaacctactacacatgtgttatgtttggat |
10181242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 275 - 332
Target Start/End: Original strand, 10185855 - 10185912
Alignment:
| Q |
275 |
attagtgatatgccaattttaattgtttaaatgtttgaatgcaacttcgacctgttat |
332 |
Q |
| |
|
||||||||||| |||||| |||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
10185855 |
attagtgatattccaattgtaattgtttatatgtttgaatgcaactttgacctgttat |
10185912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 277
Target Start/End: Original strand, 10181281 - 10181314
Alignment:
| Q |
244 |
tttggactatgctcaaaatttgttggtgcaaatt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10181281 |
tttggactatgctcaaaatttgttggtgcaaatt |
10181314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University