View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3999_low_28 (Length: 255)
Name: NF3999_low_28
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3999_low_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 11 - 255
Target Start/End: Original strand, 34467898 - 34468146
Alignment:
| Q |
11 |
cacagattgaaatagatgttcttgaagatactctaaagaagattcagagtatgtttgagcacattataggcaagactgtctagtttcattttatcnnnnn |
110 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
34467898 |
cacagattgaaatagatattcttgaagatactctaaagaagattcagagtatgtttgagcacattataggcaagactgtctagtttcctattatcttttt |
34467997 |
T |
 |
| Q |
111 |
nnn--ctttc--agttaagactttaataattgtgttgcagttctgtacgtgatgaacacaaacctttattatgataatatcgcagttaaaatttgataaa |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34467998 |
tttttctttctcagttaagactttaataattgtgttgcagttctgtgcgtgatgaacacaaacctttattatgataacatcgcagttaaaatttgataaa |
34468097 |
T |
 |
| Q |
207 |
attaatgttaccattcttctagttaaattcaagcgatgttaattgcatt |
255 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
34468098 |
attaatgttacctttcttctagttaaagtcaagcgatgtttattgcatt |
34468146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University