View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3999_low_32 (Length: 249)
Name: NF3999_low_32
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3999_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 177 - 242
Target Start/End: Complemental strand, 6314337 - 6314272
Alignment:
| Q |
177 |
aatcactgatatgtcacaagatttaacttaccaagacccagaaactccatccacaagccctttgat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6314337 |
aatcactgatatgtcacaagatttaacttaccaagacccagaaactccatccacaagcccattgat |
6314272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 6314791 - 6314723
Alignment:
| Q |
9 |
attataaaataaaaataaaatgctcagctaggcttctataccattaatgaataaattttgccagttttc |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
6314791 |
attataaaataaaaataaaatgctcagctaggcttctataccatttatgagtaaattttgccagttttc |
6314723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 151
Target Start/End: Complemental strand, 6314377 - 6314336
Alignment:
| Q |
110 |
aacccataatcataaactaaaccaatttttatatcatggcaa |
151 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
6314377 |
aacccattatcataaactaaaccaattcttatatcatggcaa |
6314336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 194 - 242
Target Start/End: Complemental strand, 56538000 - 56537952
Alignment:
| Q |
194 |
aagatttaacttaccaagacccagaaactccatccacaagccctttgat |
242 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56538000 |
aagattgaacttaccaagacccagaaactccgtccacaagccctttgat |
56537952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University