View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3999_low_32 (Length: 249)

Name: NF3999_low_32
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3999_low_32
NF3999_low_32
[»] chr5 (3 HSPs)
chr5 (177-242)||(6314272-6314337)
chr5 (9-77)||(6314723-6314791)
chr5 (110-151)||(6314336-6314377)
[»] chr4 (1 HSPs)
chr4 (194-242)||(56537952-56538000)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 177 - 242
Target Start/End: Complemental strand, 6314337 - 6314272
Alignment:
177 aatcactgatatgtcacaagatttaacttaccaagacccagaaactccatccacaagccctttgat 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
6314337 aatcactgatatgtcacaagatttaacttaccaagacccagaaactccatccacaagcccattgat 6314272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 6314791 - 6314723
Alignment:
9 attataaaataaaaataaaatgctcagctaggcttctataccattaatgaataaattttgccagttttc 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||    
6314791 attataaaataaaaataaaatgctcagctaggcttctataccatttatgagtaaattttgccagttttc 6314723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 151
Target Start/End: Complemental strand, 6314377 - 6314336
Alignment:
110 aacccataatcataaactaaaccaatttttatatcatggcaa 151  Q
    ||||||| ||||||||||||||||||| ||||||||||||||    
6314377 aacccattatcataaactaaaccaattcttatatcatggcaa 6314336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 194 - 242
Target Start/End: Complemental strand, 56538000 - 56537952
Alignment:
194 aagatttaacttaccaagacccagaaactccatccacaagccctttgat 242  Q
    |||||| |||||||||||||||||||||||| |||||||||||||||||    
56538000 aagattgaacttaccaagacccagaaactccgtccacaagccctttgat 56537952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University