View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3999_low_46 (Length: 207)
Name: NF3999_low_46
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3999_low_46 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 11 - 207
Target Start/End: Original strand, 44088665 - 44088855
Alignment:
| Q |
11 |
catcatcaatgttcaatagtttcagaaccttcaagaagcaaagatattttagaaggaaagaaagaacttatggaaatgattcaagacatgcccgagtcta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44088665 |
catcatcaatgttcaatagtttcagaaccttcaagaagcaaagatattttagaaggaaagaaagaacttatggaaatgattcaagacatgcccgagtcta |
44088764 |
T |
 |
| Q |
111 |
gctatgaactctcttttcaagacatggttgttgagcagcatcaagttccacaaccagaaacagaaacagaaccagtgtatagtaaatttcaacaacc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44088765 |
gctatgaactctcttttcaagacatggttgttgagcagcatcaagtt------ccagaaacagaaacagaaccagtgtatagtaaatttcaacaacc |
44088855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University