View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3999_low_47 (Length: 205)
Name: NF3999_low_47
Description: NF3999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3999_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 14 - 170
Target Start/End: Original strand, 51430229 - 51430387
Alignment:
| Q |
14 |
aatatcatcattcctctcaaaaacacaaatatcatcataaaatatacacgttatttggagccaaaatttaattccctcaaatatga--nnnnnnnnnnaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
51430229 |
aatatcatcattcctctcaaaaacacaaatatcatcataaaatatacacgttatttggagccaaaatttaattccctcaaatatgaatttttttttttaa |
51430328 |
T |
|
| Q |
112 |
gaggccctcaaatatgaacaattaatattaatgtctaccaaaaaatagtcttacataag |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51430329 |
gaggccctcaaatatgaacaattaatattaatgtctaccaaaaaatagtcttacataag |
51430387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University