View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4000_high_14 (Length: 237)
Name: NF4000_high_14
Description: NF4000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4000_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 1041426 - 1041277
Alignment:
| Q |
1 |
aatgatttatacacaccacattcgtttggtctatcacttcaacattgtccaatctacaaacttagaagactaccaattttggaaatatataacccaaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
1041426 |
aatgatttatacacaccacattcgtttggtcgatcacttcaacattgtccaatctacaaacttagaagactaccaattttggtcatatacaacccaaaac |
1041327 |
T |
 |
| Q |
101 |
ttaactctgtgaatgcacaaaaatggttaccacataatattaagagtata |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1041326 |
ttaactctgtgaatgcacaaaaatggttaccacataatattaagagtata |
1041277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 1045313 - 1045254
Alignment:
| Q |
1 |
aatgatttatacacaccacattcgtttggtctatcacttcaacattgtccaatctacaaa |
60 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
1045313 |
aatgatttatacacaccacatttgtttggtcgatcacatcaacattgtccaatctacaaa |
1045254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University