View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4000_high_17 (Length: 227)
Name: NF4000_high_17
Description: NF4000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4000_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 11 - 124
Target Start/End: Complemental strand, 39527826 - 39527713
Alignment:
| Q |
11 |
aatgcagtactaccacattctagccgaagttttacacgtcattcattctgcaacgacttttccaacatttctaactggctagctgctctttccacaatta |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39527826 |
aatgcagttctaccacattctagccgaagttttacacgtcattcattctgcaacgacttttccaacatttctaactagctagctgctctttccacaatta |
39527727 |
T |
|
| Q |
111 |
gaagttttctttta |
124 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39527726 |
gaagttttctttta |
39527713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 39527432 - 39527334
Alignment:
| Q |
123 |
tagaaactatacgtcatggtagcttattatttcacaagttaactactttggtttgatttgtgtagaatataatataatggattgccaatgatgtataag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39527432 |
tagaaactatacgtcatggtagcttattatttcacaagttaattactttggtttgctttgtgtagaatataatataatggattgccaatgatgtataag |
39527334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University