View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4000_low_13 (Length: 250)
Name: NF4000_low_13
Description: NF4000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4000_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 83 - 236
Target Start/End: Original strand, 36524234 - 36524387
Alignment:
| Q |
83 |
ttcgcgaggtgaaaatgagcatagtgcaagagcttgaatttgagaagaagataaggaggcaaactgagagactgaacatgaagatttccaaagaaatgga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524234 |
ttcgcgaggtgaaaatgagcatagtgcaagagcttgaatttgagaagaagataaggaggcaaactgagagactgaacatgaagatttccaaagaaatgga |
36524333 |
T |
 |
| Q |
183 |
gaacataaaagattcctattcaaaactctctaaggaacacgaaatggagaaaag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524334 |
gaacataaaagattcctattcaaaactctctaaggaacacgaaatggagaaaag |
36524387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University