View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4000_low_13 (Length: 250)

Name: NF4000_low_13
Description: NF4000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4000_low_13
NF4000_low_13
[»] chr2 (1 HSPs)
chr2 (83-236)||(36524234-36524387)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 83 - 236
Target Start/End: Original strand, 36524234 - 36524387
Alignment:
83 ttcgcgaggtgaaaatgagcatagtgcaagagcttgaatttgagaagaagataaggaggcaaactgagagactgaacatgaagatttccaaagaaatgga 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36524234 ttcgcgaggtgaaaatgagcatagtgcaagagcttgaatttgagaagaagataaggaggcaaactgagagactgaacatgaagatttccaaagaaatgga 36524333  T
183 gaacataaaagattcctattcaaaactctctaaggaacacgaaatggagaaaag 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36524334 gaacataaaagattcctattcaaaactctctaaggaacacgaaatggagaaaag 36524387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University