View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4001_high_30 (Length: 237)
Name: NF4001_high_30
Description: NF4001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4001_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 103 - 221
Target Start/End: Original strand, 30313659 - 30313777
Alignment:
| Q |
103 |
gttcacttgatttatgttggatgtcaagtgcgagtacaatctcatcaaatcgcttcattagtactaaagtacaagggtgtgaaaaagggataattgagag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30313659 |
gttcacttgatttatgttggatgtcaagtacgagtacaatctcatcatatcgcttcattagtactaaagtacaagggtgtgaaaaagggataattgagag |
30313758 |
T |
 |
| Q |
203 |
agataaagtgggttgtgga |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30313759 |
agataaagtgggttgtgga |
30313777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 30313557 - 30313609
Alignment:
| Q |
1 |
atttacgtattttcaattctctcatgatatttccttcgacttttacttcttcc |
53 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30313557 |
atttacgtattttcaattctctcataatatttccttcgacttttacttcttcc |
30313609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University