View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4001_high_31 (Length: 218)
Name: NF4001_high_31
Description: NF4001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4001_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 34334888 - 34334685
Alignment:
| Q |
1 |
cgataaaagaatcacattcagcacatgtctacttgtaacaaaaaa-tcagcacatgtctactgcatcagaacaatcttatttagttacgtagtagtactt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34334888 |
cgataaaagaatcacattcagcacatgtctacttgtaacaaaaaaatcagcacatgtctactgcatcaaaacaatcttatttagttacgtagtagtactt |
34334789 |
T |
 |
| Q |
100 |
aatagtagccaaacagtgatgttagacagaacctttgccaaattacgcacaaaattagataaacatcccaacaatattttttgtatcatatcctctttca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34334788 |
aatagtagccaaacagtgatgttagacagaacctttgccaaattactcacaaaattagataaacatcccaacaatattttttgtatcatatcctctttca |
34334689 |
T |
 |
| Q |
200 |
aatc |
203 |
Q |
| |
|
|||| |
|
|
| T |
34334688 |
aatc |
34334685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University