View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4001_low_1 (Length: 528)
Name: NF4001_low_1
Description: NF4001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4001_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 45 - 276
Target Start/End: Original strand, 38178914 - 38179145
Alignment:
| Q |
45 |
tagcttattaatctaatttatatatacgaatttactagatatgaagaaaaattgacatcaggtatgttggttgctctcttgcatgttgtaatatctctat |
144 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38178914 |
tagcttattaatttaatttatatatacgaatttactagatatgaagaaaaattgacatcaggtatgttggttgctctcttgcatgttgtaatatgtctat |
38179013 |
T |
 |
| Q |
145 |
aaatcaagtatgttgtcatcatgtgaatttagagaaatgcattttcggggttttatttgatgcttaaatgaaatcccatgtctttgtaatgtgtgattca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38179014 |
aaatcaagtatgttgtcatcatgtgaatttagagaaatgcattttcagggttttatttgatgcttaaatgaaatcccatgtctttgtaatgtgtgattca |
38179113 |
T |
 |
| Q |
245 |
gaaatccgtgcttctggttatgaatctcttta |
276 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
38179114 |
gaaatccgtgcttctggttatgaacctcttta |
38179145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 381 - 520
Target Start/End: Original strand, 38179190 - 38179329
Alignment:
| Q |
381 |
atctgtccatccagtctagttcatcagacacactttctttccttcttctttcccaacacgtacgcgcagcacaacctgtcaaccactatcaccaaccgtc |
480 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38179190 |
atctgtccatccagtctagttcatcagacacactttctttccttcttctttcccaacacgtacgcgcagcacaacctgtcaaccactatcaccaaccgtc |
38179289 |
T |
 |
| Q |
481 |
atctctcttctctcagcccagcaccccgcaacagctctgt |
520 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38179290 |
atctctcctctctcagcccagcaccccgcaacagctctgt |
38179329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 95; Significance: 3e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 124 - 276
Target Start/End: Original strand, 49006846 - 49006997
Alignment:
| Q |
124 |
tgcatgttgtaatatctctataaatcaagtatgttgtcatcatgtgaatttagagaaatgcatttt-cggggttttatttgatgcttaaatgaaatccca |
222 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
49006846 |
tgcatgttgtaatatgtctagaaatcaagtatgttgtcatcatgtgaattaagagaactgcattttagggggttttatttgatgcttaaatgaaatttca |
49006945 |
T |
 |
| Q |
223 |
tgtctttgtaatgtgtgattcagaaatccgtgcttctggttatgaatctcttta |
276 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
49006946 |
tgtctttgtaa--tgtgaatcacaaatccgtgcttctggttatgaacctcttta |
49006997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 492
Target Start/End: Original strand, 40994392 - 40994464
Alignment:
| Q |
422 |
cttcttctttcccaacacgtacgcgcag--cacaacctgtcaaccactatcaccaaccgtcatctctcttctc |
492 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| || ||||| ||||| |||||| |||||| |||| |
|
|
| T |
40994392 |
cttcttctttcccaacacgcacgcgcagcacacaacctttccaccaccgtcacccaccgtcgtctctcctctc |
40994464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University