View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4001_low_14 (Length: 330)
Name: NF4001_low_14
Description: NF4001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4001_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 47248484 - 47248173
Alignment:
| Q |
1 |
tgtcactagttcaacttccctccttcactaacaaaataataactaacaagtgcaacatttgccatttaaaagatactagtattttattaaaaa-cataca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
47248484 |
tgtcactagttcaacttccctccttcactaacaaaataataactaacaagtgcaacatttgccatttaaaagatactagtattttataaaaaaacataca |
47248385 |
T |
 |
| Q |
100 |
taagtctactgcatcagtttatatgacgatgtttgggatagactttgcaaagttcacaaattttggtgtaataatttttgcgggaggtctatatcggctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47248384 |
taagtctactgcatcagtttatatgacgatgtttgggagagactttgcaaagttcacaaattttggtgtaataatttttgcgggaggtctatatcggctt |
47248285 |
T |
 |
| Q |
200 |
atataattttgttggaaaatgttgaagaatctcaattatatgagaggtgaccggaacaccgttgaagtatcagatgatcaagtgttaaagtgtttaaaaa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47248284 |
atataattttgttggaaaatgttgaagaatctcaattatatgagaggtgatcggaacaccgttgaagtgtcagatgatcaagtgttaaagtgtttaaaaa |
47248185 |
T |
 |
| Q |
300 |
tggggtagtctt |
311 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
47248184 |
tgggatagtctt |
47248173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University