View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4001_low_18 (Length: 281)

Name: NF4001_low_18
Description: NF4001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4001_low_18
NF4001_low_18
[»] chr4 (2 HSPs)
chr4 (182-267)||(3768147-3768232)
chr4 (15-47)||(3768415-3768447)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 182 - 267
Target Start/End: Complemental strand, 3768232 - 3768147
Alignment:
182 aaacattttatcttctacacactagttnnnnnnnttaacataaaaaccaaaatacacaggtaagatcaaaattttgatgtccaaaa 267  Q
    |||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||    
3768232 aaacattttatcttctacacactagttataaaaattaacataaaaaccaaaatacacaggtaagatcaaaattttgatgtccaaaa 3768147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 47
Target Start/End: Complemental strand, 3768447 - 3768415
Alignment:
15 acctgtgcaacagttcgttttcaaccacttcgt 47  Q
    |||| ||||||||||||||||||||||||||||    
3768447 acctatgcaacagttcgttttcaaccacttcgt 3768415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University