View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4001_low_18 (Length: 281)
Name: NF4001_low_18
Description: NF4001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4001_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 182 - 267
Target Start/End: Complemental strand, 3768232 - 3768147
Alignment:
| Q |
182 |
aaacattttatcttctacacactagttnnnnnnnttaacataaaaaccaaaatacacaggtaagatcaaaattttgatgtccaaaa |
267 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3768232 |
aaacattttatcttctacacactagttataaaaattaacataaaaaccaaaatacacaggtaagatcaaaattttgatgtccaaaa |
3768147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 47
Target Start/End: Complemental strand, 3768447 - 3768415
Alignment:
| Q |
15 |
acctgtgcaacagttcgttttcaaccacttcgt |
47 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
3768447 |
acctatgcaacagttcgttttcaaccacttcgt |
3768415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University