View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4002_high_18 (Length: 247)
Name: NF4002_high_18
Description: NF4002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4002_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 115 - 225
Target Start/End: Original strand, 22996457 - 22996565
Alignment:
| Q |
115 |
aataagttatttggatttattcattattaataacttacacatcaacagttagctctatttcattttaacgagacggtttgaatcttagaccagctgcatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22996457 |
aataagttatttggatttattcattattaataacttaca--tcaatagatagctctatttcattttaacgagacggtttgaatcttagatcagctgcatt |
22996554 |
T |
 |
| Q |
215 |
acataatatgt |
225 |
Q |
| |
|
|||| |||||| |
|
|
| T |
22996555 |
acatgatatgt |
22996565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 923694 - 923737
Alignment:
| Q |
1 |
tagatagaaaaatggtgtcttcttagagtttagaaatgaatgca |
44 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
923694 |
tagatagaaaaatagtgtctttttagagtttagaaatgaatgca |
923737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 46833203 - 46833160
Alignment:
| Q |
1 |
tagatagaaaaatggtgtcttcttagagtttagaaatgaatgca |
44 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
46833203 |
tagataaaaaaatggtgtctttttagagtttaaaaatgaatgca |
46833160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University