View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4002_high_18 (Length: 247)

Name: NF4002_high_18
Description: NF4002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4002_high_18
NF4002_high_18
[»] chr2 (2 HSPs)
chr2 (115-225)||(22996457-22996565)
chr2 (1-44)||(923694-923737)
[»] chr3 (1 HSPs)
chr3 (1-44)||(46833160-46833203)


Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 115 - 225
Target Start/End: Original strand, 22996457 - 22996565
Alignment:
115 aataagttatttggatttattcattattaataacttacacatcaacagttagctctatttcattttaacgagacggtttgaatcttagaccagctgcatt 214  Q
    |||||||||||||||||||||||||||||||||||||||  |||| || |||||||||||||||||||||||||||||||||||||||| ||||||||||    
22996457 aataagttatttggatttattcattattaataacttaca--tcaatagatagctctatttcattttaacgagacggtttgaatcttagatcagctgcatt 22996554  T
215 acataatatgt 225  Q
    |||| ||||||    
22996555 acatgatatgt 22996565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 923694 - 923737
Alignment:
1 tagatagaaaaatggtgtcttcttagagtttagaaatgaatgca 44  Q
    ||||||||||||| ||||||| ||||||||||||||||||||||    
923694 tagatagaaaaatagtgtctttttagagtttagaaatgaatgca 923737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 46833203 - 46833160
Alignment:
1 tagatagaaaaatggtgtcttcttagagtttagaaatgaatgca 44  Q
    |||||| |||||||||||||| |||||||||| |||||||||||    
46833203 tagataaaaaaatggtgtctttttagagtttaaaaatgaatgca 46833160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University