View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4002_low_17 (Length: 289)
Name: NF4002_low_17
Description: NF4002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4002_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 278
Target Start/End: Complemental strand, 3447586 - 3447326
Alignment:
| Q |
19 |
taggctatcctcaaaattgatttcaaccgaa-caggtagcttgatgctttgatataacaactgaattttgattgttttgagtgcactttatgtcctaaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447586 |
taggctatcctcaaaattgatttcaaccgaaacaggtagcttgatgctttgatataacaactgaattttgattgttttgagtgcactttatgtcctaaac |
3447487 |
T |
|
| Q |
118 |
tgttcctgcatttgaatgttttgattgttaagtcggccttttctgaatattggccttgtcttggatttggttgctttgaattgctgagttggtccttttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447486 |
tgttcctgcatttgaatgttttgattgttaagtcggccttttctgaatattggccttgtcttggatttggttgctttgaattgctgagttggtcctttta |
3447387 |
T |
|
| Q |
218 |
tgtgtgaaataaagaacaaataggttcctttatgtgaattttgtaaattgaacttgatgat |
278 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447386 |
tgtgtgaaataaagaacaaaaaggttcctttatgtgaattttgtaaattgaacttgatgat |
3447326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University