View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4002_low_20 (Length: 249)
Name: NF4002_low_20
Description: NF4002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4002_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 239
Target Start/End: Complemental strand, 37343253 - 37343025
Alignment:
| Q |
14 |
agggaaacaaaatagtacataaagagaaaatagggttgacctttgtgctttggaggagatttcctgtgagaattggatactattttccttattaaaactc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37343253 |
agggaaacaaaatagtacataaagagaaaatagggttgacctttgtgctttggaggagatttcctgtgagaattggatactattttccttattaaaactc |
37343154 |
T |
 |
| Q |
114 |
atctttcaaccaaatacattcaatgagaatgacgaacaaagtataacaattggaccactacaacaaactctacttgcacagcagcaggcctgatcaagac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37343153 |
atctttcaaccaaatacattcaatgagaatgacgaacaaagtataacaattggaccactacaacaaactctacttgcacagcagcaggcctgatcaagaa |
37343054 |
T |
 |
| Q |
214 |
aaaattgacgcc---atctactgaggtca |
239 |
Q |
| |
|
|||||||| ||| |||||||||||||| |
|
|
| T |
37343053 |
aaaattgaggccactatctactgaggtca |
37343025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University