View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4002_low_27 (Length: 229)
Name: NF4002_low_27
Description: NF4002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4002_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 93 - 216
Target Start/End: Complemental strand, 27433647 - 27433524
Alignment:
| Q |
93 |
cgtcaataatatcagtacatgcaggggacaaagtaagtactacgtaagatttgattgagacatttccaatgcatggaggctaaataaataactatacacg |
192 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27433647 |
cgtcaataatatcagtacatgcataggaccaagtaagtactacgtaagatttgattgagacatttccaatggatggaggctaaataaataactatacacg |
27433548 |
T |
|
| Q |
193 |
ccgtagaatagttccatataagtg |
216 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27433547 |
ccgtagaatagttccatataagtg |
27433524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 117 - 182
Target Start/End: Original strand, 27442987 - 27443054
Alignment:
| Q |
117 |
gggacaaagtaagtacta--cgtaagatttgattgagacatttccaatgcatggaggctaaataaata |
182 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27442987 |
gggacaaagtaagtattatacgtaagatttgattgagacatttccaatgcatggaggctaaataaata |
27443054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University