View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4002_low_3 (Length: 475)

Name: NF4002_low_3
Description: NF4002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4002_low_3
NF4002_low_3
[»] chr8 (1 HSPs)
chr8 (10-62)||(5094485-5094537)


Alignment Details
Target: chr8 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 5094537 - 5094485
Alignment:
10 aagaaaataaaaatcgtacgctcccttacatttctaataaattttagaacttc 62  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||||    
5094537 aagaaaataaaaatcgtatactcccttacatttctaataaattttagaacttc 5094485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University