View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4002_low_30 (Length: 205)
Name: NF4002_low_30
Description: NF4002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4002_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 15 - 188
Target Start/End: Original strand, 3433725 - 3433898
Alignment:
| Q |
15 |
gagaatcattcaaatttgattaaaagcaatcacacatgtgcgtgacagagagacatgatcacatctccatccaaaatcctaaagcattagggttatggtt |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||| |
|
|
| T |
3433725 |
gagaatcattcatatttgattaaaagcaatcacacatgtgagtgacagagagacatgatcacatctccattcaaaaccctaaagcatcagggttatggtt |
3433824 |
T |
 |
| Q |
115 |
tctcttgcttatatgtttcattttctaattcaatataaaaattttgctcgagaggaatttaatgcgagacttct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
3433825 |
tctcttgcttatatgtttcattttctaattcaatgtgaaaattttgctcgagaggaattcaatacgagacttct |
3433898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University