View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4004_low_1 (Length: 421)
Name: NF4004_low_1
Description: NF4004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4004_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 19 - 408
Target Start/End: Complemental strand, 35722393 - 35722005
Alignment:
| Q |
19 |
gaatatagtcactagcttatttgaagaagaagnnnnnnncgctactaaacaagaacaattgcaaattaattaataatttaggttgttataggtggttcca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35722393 |
gaatatagtcactagcttatttgaagaagaa-aaaaaaacgctactaaacaagaacaattgcaaattaattaataatttaggttgttataggtggttcca |
35722295 |
T |
 |
| Q |
119 |
tccaaaaccaaagtaggaggtgttattctcacttattatcattgtagtgcatggcccataaggttgccttgtgagggtgatcacaccgacaactatagca |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35722294 |
tccaaaaccaaagtaggaggtgtgattctcacttattatcattgtagtgcatggcccataaggttgccttgtgagggtgatcacaccgacaactatagca |
35722195 |
T |
 |
| Q |
219 |
acgagcnnnnnnnggatctgaaatcaaattattccattgtttggagacacttttgaacctaaatagagactttataggaagatacacaagaatttccctt |
318 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35722194 |
acgagcaaaaaaaggatctgaaatcaaattattccattgtttggagacacttttgaacctaaatagagactttataggaagatacacaagaatttccctt |
35722095 |
T |
 |
| Q |
319 |
atgacaagttcgggcaagtcaccattgttcggcatcacttgcttgttattgacttcatatgccatttgagaaccctcttgagtgtctatt |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35722094 |
atgacaagttcgggcaagtcaccattgttcggcatcacttgcttgttattgacttcatatgccatttgagaaccctcttgagtgtctatt |
35722005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University