View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_high_40 (Length: 285)
Name: NF4005_high_40
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 6 - 195
Target Start/End: Original strand, 54718976 - 54719168
Alignment:
| Q |
6 |
aagtaacattttcgtcggaattggggtcccataataagggtttgttatggttagggtcgagagtgttccatgaaggaggaagattggtggagaggatttg |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54718976 |
aagtgacattttcgtcggaattggggtcccataataagggtttgttatggtttgggtcgagagtgttccatgaaggaggaagattggtggagaggatttg |
54719075 |
T |
 |
| Q |
106 |
tttgagaaaatcgtcgtgatggttggatgtgtcgttgtga---ttgttgttgttgttaatttggatctgactttggagaggaatgggaatttc |
195 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54719076 |
tttgagaaaatcgtcgtgatggttgaatgtgtcgttgtgattgttgttgttgttgttaatttggatctgactttggagaggaatgggaatttc |
54719168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University