View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_high_44 (Length: 272)
Name: NF4005_high_44
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 12 - 258
Target Start/End: Original strand, 50766942 - 50767188
Alignment:
| Q |
12 |
acagacacagttaaaacatcatcccatgcatcaagagatggtggaagcttatccagtgaaccccaaattctctcagaatccacttccttttgaagatact |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50766942 |
acagacacagttaaaacgtcatcccatgcatcaagagatggtggaagcttatccagtgaaccccaaattctctcagaatccacttccttttgaagatact |
50767041 |
T |
 |
| Q |
112 |
ccaaaatctgcagtgcagtgggactcaacactgggaaaatcccatcaacaaatccagaaccaaacttccatcctcttcctctcaaagaaccacctactca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50767042 |
ccaaaatctgcagtgcagtgggactcaacactgggaaaatcccatcaacaaatccagaaccaaacttccatcctcttcctctcaaagaaccacctactca |
50767141 |
T |
 |
| Q |
212 |
aagaaaataacaacactgtttacacatacaaaacttgtgttgtgttt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50767142 |
aagaaaataacaacactgtttacacatacaaaacttgtgttgtgttt |
50767188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University