View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_high_47 (Length: 267)
Name: NF4005_high_47
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 34666579 - 34666826
Alignment:
| Q |
1 |
taagatgatgcctcctttgattttttggaagttttgatttgagggagtcgttgccgatggagacgatacgaaggatactannnnnnnnnnggtagatata |
100 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| | |
|
|
| T |
34666579 |
taagatgatgccacctttgatttgttggaagttttgatttgagggagtcgttgccgatggagacgatacgaaggacactattttttttttggtagataga |
34666678 |
T |
 |
| Q |
101 |
ctaaatagcaaagacattgtaaactcacataagtggaagtgtcaaagttcaaacctcggccaaaatgataaattaatctttgaaaatggtgtaaattgaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34666679 |
ctaaatagcaaagacattgtaaattcacataagtggaagtgtcaaagttcgaacctcggccaaaatgataaattaatctttgaaaatggtgtaaattgaa |
34666778 |
T |
 |
| Q |
201 |
ggggtatacatctagaatggtaaagtcttcaatcaaccagtgcggtgt |
248 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
34666779 |
ggggtctacatcgagaatggtaaagtcttcaattaaccagtgcggtgt |
34666826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University