View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_high_51 (Length: 258)
Name: NF4005_high_51
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_high_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 30940671 - 30940436
Alignment:
| Q |
8 |
aagcataggaagtttgctagttgataaacctttttgcggtccttgatcaattctgcataagtttactcgtttctttacactcgatattgtagaactcagt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30940671 |
aagcataggaagtttgctagttgataaaccttttcgcggtccttgatcaattctgcataagtttactcgtttctttacactcgatattgtagaactcagt |
30940572 |
T |
|
| Q |
108 |
tctcggcgtagttctggctgccaagcactttggagatcccctaacaacagtaccgtgtgctgtttcaagtgtgtgtcactctatctttggtagcatcttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30940571 |
tctcggcgtagttctggctgccaagcactttggagatcccctaacaacagtaccgtgtgctgtttcaagtgtgtgtcactctatctttggtagcatcttg |
30940472 |
T |
|
| Q |
208 |
gctggaatgtggagacgctctgtgcctcctgagaag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30940471 |
gctggaatgtggagacgctctgtgcctcctgagaag |
30940436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 95 - 221
Target Start/End: Complemental strand, 30983502 - 30983376
Alignment:
| Q |
95 |
tgtagaactcagttctcggcgtagttctggctgccaagcactttggagatcccctaacaacagtaccgtgtgctgtttcaagtgtgtgtcactctatctt |
194 |
Q |
| |
|
|||||||| ||| ||| || || ||||| ||| |||| |||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
30983502 |
tgtagaacgcagctcttggtgttgttctcgctaccaatcactttggagatcctctaacaacagtaccttgtgctgtttcaagtgtgtgtcactcaatctt |
30983403 |
T |
|
| Q |
195 |
tggtagcatcttggctggaatgtggag |
221 |
Q |
| |
|
|||||| |||||||| ||||| ||||| |
|
|
| T |
30983402 |
tggtagtatcttggcaggaatttggag |
30983376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University