View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_high_52 (Length: 257)
Name: NF4005_high_52
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_high_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 31823090 - 31822849
Alignment:
| Q |
1 |
gaacaacaagtatttttataatttatcccgcaaagttaacatgcaatgtgaaaagtttgattcttaaaggnnnnnnn-gttacttataggttttttgtta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31823090 |
gaacaacaagtatttttataatttatcccgcaaagttaacgtgcaatgtgaaaagtttgattcttaaaggttttttttgttacttataggttttttgtta |
31822991 |
T |
|
| Q |
100 |
aacctataagtaacctcatttgcttgtttaagaacatacttcacgagttcacgttgaagttatgagtaaaagagagtagccaagagtattttgtgacaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31822990 |
aacctataagtaacctcatttgcttgcttaagaacatactttacgagttcacgttgaagttatgagtaaaagagagtagccaagagtattttgtgataat |
31822891 |
T |
|
| Q |
200 |
agatccaaactcatgagtttactccaagagaatggatgtaac |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31822890 |
agatccaaactcatgagtttactctaagagaatggatgtaac |
31822849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University