View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_high_57 (Length: 248)
Name: NF4005_high_57
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_high_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 31823198 - 31823376
Alignment:
| Q |
1 |
ggtacaacctgatattaatcaatttcggcaaacatattgatcgattaattcacataaattgatttttggatnnnnnnnngattttggtaagtaaaactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
31823198 |
ggtacaacctgatattaatcaatttcggcaaacatattgatcgattaattcacataaattgacttttggataaaaaaaagattttggtaagtaaaactag |
31823297 |
T |
 |
| Q |
101 |
agtctaacctaaagcgccataaagccgactgtaa-gattgttgtctacaactccaacgacacttaactgccgttagagg |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31823298 |
agtctaacctgaagcgccataaagccgattgtaaggattgttgtctacaactccaacgacacttaactgccgttagagg |
31823376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 201 - 244
Target Start/End: Original strand, 31823399 - 31823442
Alignment:
| Q |
201 |
gttcctgtatatgcaggttcataatacaacgagaattatctacc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31823399 |
gttcctgtatatgcaggttcataatacaacgagaattaactacc |
31823442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University