View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_high_73 (Length: 211)
Name: NF4005_high_73
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_high_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 33 - 195
Target Start/End: Original strand, 41074201 - 41074363
Alignment:
| Q |
33 |
gtatcttatctttgaattgtccttttttaaggttgttatagatttccaaaaatttagtttgttatgatgaaatcaaaacctcaatcacaattatttttaa |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41074201 |
gtatcttatctttgaattgtccttttttaaggttgttatagatttccaaaaatttagtttgttatgatgaaatcaaaacctcaatcacaattattattat |
41074300 |
T |
 |
| Q |
133 |
gattattattatcaaattaagtttctcagtccatcatgcatgatttagattttgccttttttg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41074301 |
gattattattatcaaattaagtttctcagtccatcatgcatgatttagattttgccttttttg |
41074363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University