View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_low_42 (Length: 293)
Name: NF4005_low_42
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 4211229 - 4210966
Alignment:
| Q |
18 |
gtttctatagaagaggttttcatgaagttgcaaggccaaggaggtaatttcacaaggacacattcagacactaagccggattccggggaggttccggtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211229 |
gtttctatagaagaggttttcatgaagttgcaaggccaaggaggtaatttcacaaggacacattcagacactaagccggattccggggaggttccggtga |
4211130 |
T |
|
| Q |
118 |
agctgtcgaggaagatgaagaaatctgctagcagtaaatctgctttttcacattttaaggaagatgacattgtggagaaacgccggccagccaccgtgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211129 |
agctgtcgaggaagatgaagaaatctgctagcagtaaatctgctttttcacattttaaggaagatgacattgtggagaaacgccggccagccaccgtgaa |
4211030 |
T |
|
| Q |
218 |
agaggcgaaggttgttccggctgcagtggatgaggatgagttggttgattctaaggctgatgat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211029 |
agaggcgaaggttgttccggctgcagtggatgaggatgagttggttgattctaaggctgatgat |
4210966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University