View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_low_66 (Length: 238)
Name: NF4005_low_66
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 26460715 - 26460516
Alignment:
| Q |
18 |
atttctcaaatataatgatacgaatcagctgtcatctttatatgaaatatttttaggtaaagagttttcgagtcaaacatattgtatagttcataaagta |
117 |
Q |
| |
|
||||| |||| ||||||||| ||||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26460715 |
atttcccaaaaataatgatatgaatcagttgccatctttatatgaaacatttttaggtaaagagttttcgagtcaaacatattgtatagttcataaagta |
26460616 |
T |
 |
| Q |
118 |
tacaatagaaaataacataggactctaagaacataaacctaaattggtccctaactctatgctaagatgacatggtacaataacctagtaatgacgtcaa |
217 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26460615 |
tacaatacgaaataacataggactctacaaacataaatctaaattggtccctaactctatgctaagatgacagggtacaataacctagtaatgacgtcaa |
26460516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University