View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_low_75 (Length: 220)
Name: NF4005_low_75
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_low_75 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 20 - 204
Target Start/End: Original strand, 5475907 - 5476077
Alignment:
| Q |
20 |
gcatttagggtctaaaatgaat-tttaatcttaatatttgcataattgatatggtgtctgtttggattaacttatttgaagttgaaggggaaaaacctag |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5475907 |
gcatttagggtctaaaatgaatgtttaatcttaatatttgcataattgatatgatgtctgtttggattaacttatttgaagttgaaggggaaa------- |
5475999 |
T |
|
| Q |
119 |
ttttttataacttagttttttataactatttccataaaaactgtgaaaatactatgactttgttttatcctttgttatataatact |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5476000 |
--------aacttagttttttataactatttccataaaaactctgaaaatactatgactttgttttatcctttgttatataatact |
5476077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 62 - 132
Target Start/End: Original strand, 8403371 - 8403441
Alignment:
| Q |
62 |
aattgatatggtgtctgtttggattaacttatttgaagttgaaggggaaaaacctagttttttataactta |
132 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8403371 |
aattgatatggtttctgtttggattaacttatttgaagttgaaggggaaaaacttagttttttataactta |
8403441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University