View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_low_76 (Length: 215)
Name: NF4005_low_76
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_low_76 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 10239463 - 10239281
Alignment:
| Q |
19 |
ggattgatcaacacaagtttggctctgtttggcaaccgtctttttgctttaggagaatcagatcttccttatgaaatcaaagttacaccaaacggtgata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10239463 |
ggattgatcaacacaagtttggctctgtttggcaaccgtctttttgctttaggagaatcagatcttccttatgaaatcaaagttacaccaaacggtgata |
10239364 |
T |
 |
| Q |
119 |
tccaaacaatcggccgttatgattttaacggcaaactcttcatgaatatgacggcgcatcctaaaattgactccgacacaggt |
201 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10239363 |
tccaaacaataggccgttatgattttaacggcaaactcttcatgaatatgacggcgcatcctaaaattgactccgacacaggt |
10239281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 10230683 - 10230504
Alignment:
| Q |
19 |
ggattgatcaacacaagtttggctctgtttggcaaccgtctttttgctttaggagaatcagatcttccttatgaaatcaaagttacaccaaacggtgata |
118 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||| | |
|
|
| T |
10230683 |
ggattggtcaacacaagtttagctctgtttggtaaccgtctttttgctttaggagaatcagatcttccttatgaagtcaaactaacaccaaacggtgaca |
10230584 |
T |
 |
| Q |
119 |
tccaaacaatcggccgttatgattttaacggcaaactcttcatgaatatgacggcgcatcctaaaattgactccgacaca |
198 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||| ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
10230583 |
tccaaacaatgggccgttatgatttcaacggcaaactcttgatgagtatgacggcgcatcctaaaatagactctgacaca |
10230504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 27 - 201
Target Start/End: Original strand, 10255150 - 10255324
Alignment:
| Q |
27 |
caacacaagtttggctctgtttggcaaccgtctttttgctttaggagaatcagatcttccttatgaaatcaaagttacaccaaacggtgatatccaaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
10255150 |
caacacaagtttggctctgtttggtaacaaactttttgctttaggagaatcagatcttccttatgaaatcaatcttacgccaaacggtgatatccaaaca |
10255249 |
T |
 |
| Q |
127 |
atcggccgttatgattttaacggcaaactcttcatgaatatgacggcgcatcctaaaattgactccgacacaggt |
201 |
Q |
| |
|
|| |||||||||||||||||||| ||||||| ||||| |||||| || ||||| ||||||||| |||||||||| |
|
|
| T |
10255250 |
attggccgttatgattttaacggtaaactctccatgagtatgactgcacatccgaaaattgacggcgacacaggt |
10255324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University