View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4005_low_79 (Length: 210)
Name: NF4005_low_79
Description: NF4005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4005_low_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 193
Target Start/End: Complemental strand, 34827611 - 34827429
Alignment:
| Q |
11 |
aagaatatttgaagctgaaggcacgttatgaagcattacaacgatcccagaggtaatgattatgctctatttcatttttatctttgcatatagttcagtt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34827611 |
aagaatatttgaagctgaaggcacgttatgaagcattgcaacgatcccagaggtaatgattatgctctatttcatttttatctttgcatatagttcagtt |
34827512 |
T |
 |
| Q |
111 |
catacagagtaactaatactgttttaactgtgaccttgttaggaaccttatgggagaagatcttggccctctgagcagcaaag |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34827511 |
catacagagtaactaatactgttttaactgtgaccttgttaggaaccttatgggagaagatcttggccctctgagcagcaaag |
34827429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 149 - 193
Target Start/End: Original strand, 38399504 - 38399548
Alignment:
| Q |
149 |
ttaggaaccttatgggagaagatcttggccctctgagcagcaaag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38399504 |
ttaggaaccttatgggagaagatcttggccctctaagcagcaaag |
38399548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University