View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4006_low_7 (Length: 249)
Name: NF4006_low_7
Description: NF4006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4006_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 39652019 - 39651789
Alignment:
| Q |
1 |
tgcctctggattcaccacagcttccacaatactgaatggcataaacaatggtatatctcaagaatcattatctacgttggcaacaaattatggatatcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39652019 |
tgcctctggattcaccacagcttccacaatactgaatggcataaacaatggtatatctcaagaatcaggatctacgttggcaacaaattatggatatcct |
39651920 |
T |
 |
| Q |
101 |
tttcacaccgttccaagtacgtctctaggtgtacaaaaccatgccatccaaaagaagcgaggacgcaaagttcacagttttggaacgatgttcaatggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39651919 |
tttcacaccgttccaagtacgtctctaggtgtacaaaaccatgccatccaaaagaagcgaggacgcaaagttcacagttttggaacgatgttcaatggga |
39651820 |
T |
 |
| Q |
201 |
tagacaatatcagtgctaggaacacaatgac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39651819 |
tagacaatatcagtgctaggaacacaatgac |
39651789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 164
Target Start/End: Complemental strand, 39672174 - 39672133
Alignment:
| Q |
123 |
ctctaggtgtacaaaaccatgccatccaaaagaagcgaggac |
164 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39672174 |
ctctaggtgtacgaaaccatgccatccaaaagaagcgaggac |
39672133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University