View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4006_low_8 (Length: 243)

Name: NF4006_low_8
Description: NF4006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4006_low_8
NF4006_low_8
[»] chr8 (1 HSPs)
chr8 (94-231)||(26723338-26723476)
[»] chr5 (1 HSPs)
chr5 (102-175)||(38645703-38645776)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 94 - 231
Target Start/End: Original strand, 26723338 - 26723476
Alignment:
94 attacattacatctatcattttattctttttatttttctctctctagtggtagattgaatattggatgtctaggaattatttttctat-gaaaaacnnnn 192  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||        
26723338 attacattacatctatcattttattctttttatttctttctctctagtggtagattgaatattggatgtctaggaattatttttctatagaaaaacattt 26723437  T
193 nnnnnccggttaattatccatgaacacccttttttccta 231  Q
         |||| |||||||||||||||||||||||||||||    
26723438 tttttccggctaattatccatgaacacccttttttccta 26723476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 38645703 - 38645776
Alignment:
102 acatctatcattttattctttttatttttctctctctagtggtagattgaatattggatgtctaggaattattt 175  Q
    |||||||| ||| |||  ||| ||||| | |||||||||||||||||||||| |||| ||| || |||||||||    
38645703 acatctattattctatattttgtatttctttctctctagtggtagattgaattttgggtgtttaagaattattt 38645776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University