View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4007_high_6 (Length: 384)
Name: NF4007_high_6
Description: NF4007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4007_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 49753589 - 49753367
Alignment:
| Q |
18 |
gcttaattataatcaatgtaatcagagagatacgtagcagtgtcaacttggtttatatggtggtagcatgtgggtggatatagctatagatgaaatatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
49753589 |
gcttaattataatcaatgtaatcagagagatacgtagcagtgtcaacttggtttatatggtggtggcatgtgggtggatatagctataggtgaaatatta |
49753490 |
T |
 |
| Q |
118 |
acatggacgtttttggctgtttacaaatgacattatacaaagatatgatgattaactatttggttatgataggaagttttgtgtgatgtgcataagttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49753489 |
acatggacgtttttggctgtttacaaatgacattatacaaagatatgatgattaactatttggttatgataggaag--ttgtgtgatgtgcataagttaa |
49753392 |
T |
 |
| Q |
218 |
atagttttgtgttatgtataagttt |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49753391 |
atagttttgtgttatgtataagttt |
49753367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 310 - 374
Target Start/End: Complemental strand, 49753299 - 49753233
Alignment:
| Q |
310 |
gaaaaaactaacttttatatgacaca--gttatttggcggctaagttttggattactaaatctcatt |
374 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||||||||||| |||||||||| | |||||| |
|
|
| T |
49753299 |
gaaaaaactaacttttatatgatacaaagttatttcgcggctaagttctggattactagacctcatt |
49753233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 57 - 96
Target Start/End: Complemental strand, 49750193 - 49750154
Alignment:
| Q |
57 |
gtgtcaacttggtttatatggtggtagcatgtgggtggat |
96 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
49750193 |
gtgtcagcttggtttatatggtggtagcttgtgggtggat |
49750154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University